WormMine: Gene WBGene00131179

• WormBase Gene ID: WBGene00131179
• Gene Name: CJA11975
• Sequence Name: CJA11975
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Winged helix DNA-binding domain superfamily; PA2G4 family; Peptidase M24; Winged helix-like DNA-binding domain superfamily; Creatinase/aminopeptidase-like; and Metallopeptidase family M24. Is an ortholog of C. elegans W08E12.7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA11975.1	CJA11975.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA11975	CJA11975		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1086111
• Remark: CJA11975, TTACGAGAAAGAGGGTGAGTTTGTCGCCCAGTTCAAGGCCACCGTCCTAGTCATGCCAAA, WBGene00131179
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term