WormMine: Gene WBGene00137342

• WormBase Gene ID: WBGene00137342
• Gene Name: Cjp-smu-1
• Sequence Name: CJA18138
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: CTLH, C-terminal LisH motif; G-protein beta WD-40 repeat; LisH-like dimerisation domain; WD40/YVTN repeat-like-containing domain superfamily; WD40 repeat; LIS1 homology motif; WD domain, G-beta repeat; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans smu-1. In C. elegans, smu-1 is involved in several processes, including mechanosensory behavior; nematode larval development; and regulation of alternative mRNA splicing, via spliceosome.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA18138.1	CJA18138.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA18138	CJA18138		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1079672
• Remark: Cjp-smu-1, AAAGTGATCCGCCACAAATGGTGGTTTGCAATCGATCCAACACACTCTACGTTGTCAATA, WBGene00137342
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term