WormMine: Gene WBGene00134158

• WormBase Gene ID: WBGene00134158
• Gene Name: Cjp-tom-1.1
• Sequence Name: CJA14954
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Lethal giant larvae homologue 2; WD40/YVTN repeat-like-containing domain superfamily; WD40 repeat; LLGL2; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans tom-1. In C. elegans, tom-1 is involved in several processes, including regulation of presynaptic dense core granule exocytosis; regulation of synaptic vesicle docking; and synaptic vesicle priming.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA14954a.1	CJA14954a.1		[unknown]
Transcript:CJA14954b.1	CJA14954b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA14954b	CJA14954b		[unknown]
CDS:CJA14954a	CJA14954a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1089036
• Remark: Cjp-tom-1, TTCGCTGTTCAACAACAAAAAGTGCTCAGAACCGCAGCAGAGAACGACTCCGCACGGCAC, WBGene00134158
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term