WormMine: Gene WBGene00130001

• WormBase Gene ID: WBGene00130001
• Gene Name: CJA10797
• Sequence Name: CJA10797
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domain: Glycosyltransferase family 92. Is an ortholog of C. elegans F39G3.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA10797c.1	CJA10797c.1		[unknown]
Transcript:CJA10797b.1	CJA10797b.1		[unknown]
Transcript:CJA10797a.1	CJA10797a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA10797a	CJA10797a		[unknown]
CDS:CJA10797b	CJA10797b		[unknown]
CDS:CJA10797c	CJA10797c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081170
• Remark: CJA10797, CACAATTGCCCTAAAACTTCGTCAAGTTCATCACAAACGGCCAATCGGGTTTACCGTTTG, WBGene00130001
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term