WormMine: Gene WBGene00030878

• WormBase Gene ID: WBGene00030878
• Gene Name: CBG09262
• Sequence Name: CBG09262
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Solute carrier family 3 member 2, N-terminal domain and Solute carrier family 3 member 2 N-terminus. Is an ortholog of C. elegans R01B10.3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09262.1	CBG09262.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09262	CBG09262		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069987
• Remark: CBG09262, AATCGGTTACACTCTTGAGCAGCTGAATGAGAAGAGAGAAGAACCGAAGTGGCGTATTGC, WBGene00030878
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term