WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00133405 Gene Name  CJA14201
Sequence Name  ? CJA14201 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: FERM/acyl-CoA-binding protein superfamily; KIND domain; FERM N-terminal domain; Band 4.1 domain; FERM C-terminal PH-like domain; FERM, C-terminal PH-like domain; FERM, N-terminal; FERM superfamily, second domain; Ubiquitin-like domain superfamily; FERM central domain; and PH-like domain superfamily. Is an ortholog of C. elegans frm-5.1 and frm-5.2. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA14201.1 CJA14201.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA14201 CJA14201   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA28410, ATGCGTCAATGGAAGAGCACTCTTCGCCACGAGAACACCATATCATCAATGCCGGATGTC, WBGene00183984   Expr1070818 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA14201, CCATACGTTTTGCACCTTCGATTCAAGTTTTATCCGCAGATTTTGGATTTTATCAAGTAG, WBGene00133405   Expr1083153 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA17929, GTGCATTTACGAGGAATTGATGGGCGATGAAGATGAGAATCAAATGGATGTTGGCGACAT, WBGene00137133   Expr1087092 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term