WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00132877 Gene Name  CJA13673
Sequence Name  ? CJA13673 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Vacuolar protein sorting-associated protein 13, SHR-binding domain; Vacuolar protein sorting-associated protein 13; Vacuolar protein sorting-associated protein 13, C-terminal; SHR-binding domain of vacuolar-sorting associated protein 13; and Vacuolar-sorting-associated 13 protein C-terminal. Is an ortholog of C. elegans T08G11.1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA13673.1 CJA13673.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA13673 CJA13673   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA26677, GCGAGTATGGAGATCAAAAGGTGTACTTGTACGCGCCATTCTGGCTTGTCAACAATACAG, WBGene00182249   Expr1083419 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA13673, AAAACGACAAGAGGATCTGAACAGAAAGCCGCAGTCGTTTGGAGAAGGAATGGCTCGTGG, WBGene00132877   Expr1081932 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term