WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00132685 Gene Name  Cjp-che-10
Sequence Name  ? CJA13481 Organism  Caenorhabditis japonica
Automated Description  Is an ortholog of C. elegans che-10. In C. elegans, che-10 is involved in cilium assembly. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA13481a.1 CJA13481a.1   [unknown]
Transcript:CJA13481b.1 CJA13481b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA13481b CJA13481b   [unknown]
CDS:CJA13481a CJA13481a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-dyf-14, CGCCAACTACTCTCACAAACGAAAACTTCTCGAATCGCAAATCCAACTGCTCCGCGAGCA, WBGene00132685   Expr1090726 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term