WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00132105 Gene Name  Cjp-sbsp-1
Sequence Name  ? CJA12901 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Somatomedin B domain; Somatomedin-B and thrombospondin type-1 domain-containing protein; Thrombospondin type-1 (TSP1) repeat superfamily; Thrombospondin type-1 (TSP1) repeat; and Somatomedin B-like domain superfamily. Is an ortholog of C. elegans sbsp-1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA12901.1 CJA12901.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA12901 CJA12901   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA22541, GAGATGAAGACGTGTTTTGTTGATTGCCAGGTTAAAAAATCGGCTCTAGATGGTGAGTTG, WBGene00178113   Expr1084264 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA12901, GCAACGGAATCTGGACGCGGATCAATCGAACGGACAATTGTCAGTGCCAGGTGAACTATC, WBGene00132105   Expr1086180 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term