WormMine: Gene WBGene00175489

• WormBase Gene ID: WBGene00175489
• Gene Name: CJA19918
• Sequence Name: CJA19918
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Major sperm protein (MSP) domain; Immunoglobulin-like fold; MSP (Major sperm protein) domain; and PapD-like superfamily.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA19918b.1	CJA19918b.1		[unknown]
Transcript:CJA19918a.1	CJA19918a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA19918a	CJA19918a		[unknown]
CDS:CJA19918b	CJA19918b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1078099
• Remark: CJA19918, TTTATTGATGTATGCTCCCTGCGATGAAAAGATGACTGATGTGAAGGCGTTTTTCAAAGA, WBGene00175489
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term