WormMine: Gene WBGene00131464

• WormBase Gene ID: WBGene00131464
• Gene Name: Cjp-soc-2
• Sequence Name: CJA12260
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Leucine-rich repeat; Leucine-rich repeat, typical subtype; Leucine-rich repeat domain superfamily; and Leucine rich repeat. Is an ortholog of C. elegans soc-2. In C. elegans, soc-2 is involved in several processes, including fibroblast growth factor receptor signaling pathway; positive regulation of Ras protein signal transduction; and vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA12260.1	CJA12260.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA12260	CJA12260		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1090408
• Remark: Cjp-soc-2, CGGAGGACCTCAACAATTCGTCTCCACAGTCACAATCAACATGGAGCACAATTTGATATC, WBGene00131464
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term