WormMine: Gene WBGene00131218

• WormBase Gene ID: WBGene00131218
• Gene Name: CJA12014
• Sequence Name: CJA12014
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: P-loop containing nucleoside triphosphate hydrolase; Helicase, C-terminal; and Helicase conserved C-terminal domain.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA12014c.1	CJA12014c.1		[unknown]
Transcript:CJA12014b.1	CJA12014b.1		[unknown]
Transcript:CJA12014a.1	CJA12014a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA12014a	CJA12014a		[unknown]
CDS:CJA12014c	CJA12014c		[unknown]
CDS:CJA12014b	CJA12014b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081003
• Remark: CJA12014, AAACGTCTTGTGGGAACGAATCGACGAGTTGCCGAACAAGTTGGACATTCTCAAGAAAGT, WBGene00131218
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term