WormMine: Gene WBGene00135790

• WormBase Gene ID: WBGene00135790
• Gene Name: CJA16586
• Sequence Name: CJA16586
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Aspartic peptidase domain superfamily; gag-polyprotein putative aspartyl protease; RNase H-like domain found in reverse transcriptase; Reverse transcriptase (RNA-dependent DNA polymerase); Reverse transcriptase domain; Reverse transcriptase/Diguanylate cyclase domain; DNA/RNA polymerase superfamily; and Reverse transcriptase/retrotransposon-derived protein, RNase H-like domain.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA16586a.1	CJA16586a.1		[unknown]
Transcript:CJA16586b.1	CJA16586b.1		[unknown]
Transcript:CJA16586c.1	CJA16586c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA16586c	CJA16586c		[unknown]
CDS:CJA16586b	CJA16586b		[unknown]
CDS:CJA16586a	CJA16586a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1083953
• Remark: CJA16586, TGCCAACTGCCGAAGACATCTTCACAACGCTCAATGGTGCCAAATACTTCACTCAAATCG, WBGene00135790
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term