WormMine: Gene WBGene00135506

• WormBase Gene ID: WBGene00135506
• Gene Name: Cjp-crh-2
• Sequence Name: CJA16302
• Organism: Caenorhabditis japonica
• Automated Description: Is an ortholog of C. elegans crh-2. In C. elegans, crh-2 is involved in defense response to Gram-negative bacterium; positive regulation of dauer entry; and regulation of gene expression.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA16302.1	CJA16302.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA16302	CJA16302		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1091955
• Remark: CJA16302, TGGGCATGAACCAAATCTTCACTAATCCAACACACCAATATGTCACCACCAATGTTCAAC, WBGene00135506
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term