WormMine: Gene WBGene00030371

• WormBase Gene ID: WBGene00030371
• Gene Name: Cbr-abhd-12
• Sequence Name: CBG08612
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Lysophosphatidylserine lipase ABHD12; Alpha/Beta hydrolase fold; and Serine aminopeptidase, S33. Is an ortholog of C. elegans abhd-12.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08612.1	CBG08612.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08612	CBG08612		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052002
• Remark: CBG08612, GTTTGGCCGAGATTATTGAAGAATTCGTTGGGAGTATAACTCCACCATCAACTATCACAT, WBGene00030371
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term