WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00134901 Gene Name  CJA15697
Sequence Name  ? CJA15697 Organism  Caenorhabditis japonica
Automated Description  Is an ortholog of C. elegans Y116A8C.23. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA15697b.1 CJA15697b.1   [unknown]
Transcript:CJA15697a.1 CJA15697a.1   [unknown]
Transcript:CJA15697c.1 CJA15697c.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA15697a CJA15697a   [unknown]
CDS:CJA15697b CJA15697b   [unknown]
CDS:CJA15697c CJA15697c   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA15697, GTCTCGCCGCGAGACTACGATGGTGACGGCGAAAGAGTTGGAAACACAAATTTACAAAGA, WBGene00134901   Expr1073179 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term