WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00134848 Gene Name  Cjp-nol-56
Sequence Name  ? CJA15644 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Helix hairpin bin domain superfamily; NOP5, N-terminal; NOP5NT (NUC127) domain; Nop domain; Nop, C-terminal domain; snoRNA binding domain, fibrillarin; Nop domain superfamily; and NOSIC. Is an ortholog of C. elegans nol-56. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA15644.1 CJA15644.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA15644 CJA15644   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA15644, AAGAAGAACATTGATGTGATGAAGGAGGCCGAGGAAGCTGCCGTCGAGGTCAAGGAAAAG, WBGene00134848   Expr1088870 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term