WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00134262 Gene Name  Cjp-daf-25
Sequence Name  ? CJA15058 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Zinc finger, MYND-type and MYND finger. Is an ortholog of C. elegans daf-25. In C. elegans, daf-25 is involved in several processes, including dauer exit; positive regulation of cGMP-mediated signaling; and protein localization to cell periphery. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA15058b.2 CJA15058b.2   [unknown]
Transcript:CJA15058b.1 CJA15058b.1   [unknown]
Transcript:CJA15058a.1 CJA15058a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA15058b CJA15058b   [unknown]
CDS:CJA15058a CJA15058a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA15058, AAAGTGTGCACTTCGCTGAACGGGAACCAAGAATTGGCGACTGGCACGAACAATATGATC, WBGene00134262   Expr1070357 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA00493, AACCTGACAATAGTGGAGAAAGCGATCGAGCTGGGATGTGATGTGAATGAGAAAACGAGA, WBGene00119697   Expr1082256 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term