WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00134167 Gene Name  CJA14963
Sequence Name  ? CJA14963 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: FERM/acyl-CoA-binding protein superfamily; FERM central domain; and FERM superfamily, second domain. Is an ortholog of C. elegans frm-1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA14963b.1 CJA14963b.1   [unknown]
Transcript:CJA14963a.1 CJA14963a.1   [unknown]
Transcript:CJA14963c.1 CJA14963c.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA14963b CJA14963b   [unknown]
CDS:CJA14963a CJA14963a   [unknown]
CDS:CJA14963c CJA14963c   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA14963, CAAGTCAATGACGAGTACGAAAAGTTTATCGTTGGCGCGCGATTGGTGCCCACGGAACAC, WBGene00134167   Expr1089603 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term