WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00134114 Gene Name  CJA14910
Sequence Name  ? CJA14910 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: von Willebrand factor, type A; von Willebrand factor type A domain; and von Willebrand factor A-like domain superfamily. Is an ortholog of C. elegans C16E9.1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA14910a.1 CJA14910a.1   [unknown]
Transcript:CJA14910c.1 CJA14910c.1   [unknown]
Transcript:CJA14910b.1 CJA14910b.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA14910b CJA14910b   [unknown]
CDS:CJA14910a CJA14910a   [unknown]
CDS:CJA14910c CJA14910c   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA14910, GAACATTATTACGACTCTACTGATTTTGACAGTTTTCTTGAACATTTCCCATCGACCAAA, WBGene00134114   Expr1073119 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term