WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00137726 Gene Name  CJA18521
Sequence Name  ? CJA18521 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Winged helix DNA-binding domain superfamily; Replication protein A C terminal; Zinc finger C2H2-type; Nucleic acid-binding, OB-fold; Replication factor A protein-like; Winged helix-like DNA-binding domain superfamily; and Replication protein A, C-terminal. Is an ortholog of C. elegans F57C9.4 and rpa-2. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA18521.1 CJA18521.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA18521 CJA18521   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-rpa-2, GCAAAACTCTGCCGGATCGGACACCAAGGAAAGAATCTTCCCGGTTCAGGAGGTGAAGAA, WBGene00123216   Expr1084753 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA24925, CCTGACAGATTCAATGATTACTCCGACAAAAAAGCGAAGATGTGGTTGCGAAGACGATGG, WBGene00180497   Expr1084904 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term