WormMine: Gene WBGene00137461

• WormBase Gene ID: WBGene00137461
• Gene Name: CJA18257
• Sequence Name: CJA18257
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Receptor, ligand binding region; Receptor family ligand binding region; and Periplasmic binding protein-like I. Is an ortholog of C. elegans gcy-12. In C. elegans, gcy-12 is involved in negative regulation of dauer larval development; regulation of growth; and regulation of locomotion involved in locomotory behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA18257.1	CJA18257.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA18257	CJA18257		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1088304
• Remark: CJA18257, GATCGTGCGTACGATCCAACAGCGGACGGAAAAGCTATCATTGATCGGATTGTGAACAAA, WBGene00137461
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term