WormMine: Gene WBGene00024848

• WormBase Gene ID: WBGene00024848
• Gene Name: CBG01639
• Sequence Name: CBG01639
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: PDZ domain; FERM/acyl-CoA-binding protein superfamily; KIND domain; FERM N-terminal domain; Band 4.1 domain; FERM C-terminal PH-like domain; FERM, C-terminal PH-like domain; FERM, N-terminal; FERM superfamily, second domain; Ubiquitin-like domain superfamily; PDZ superfamily; FERM central domain; and PH-like domain superfamily. Is an ortholog of C. elegans frm-5.1 and frm-5.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01639a.1	CBG01639a.1		[unknown]
Transcript:CBG01639b.1	CBG01639b.1		[unknown]
Transcript:CBG01639c.1	CBG01639c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01639c	CBG01639c		[unknown]
CDS:CBG01639a	CBG01639a		[unknown]
CDS:CBG01639b	CBG01639b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062906
• Remark: CBG01639, GAAACTGGTACAAGGACCGGTTCAAATTACAGTAACAAGAGACTCCGCTTCCGATCGTTA, WBGene00024848
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term