WormMine: Gene WBGene00030710

• WormBase Gene ID: WBGene00030710
• Gene Name: Cbr-dpff-1
• Sequence Name: CBG09043
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: DPF1-3, N-terminal domain; PHD-finger; Zinc finger, PHD-type; Zinc finger, PHD-finger; DPF1-3, N-terminal; Zinc finger, RING/FYVE/PHD-type; Zinc finger protein DPF3; and Zinc finger, FYVE/PHD-type. Is an ortholog of C. elegans dpff-1. In C. elegans, dpff-1 is involved in apoptotic process; meiotic cell cycle; and response to heat.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09043b.1	CBG09043b.1		[unknown]
Transcript:CBG09043a.1	CBG09043a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09043b	CBG09043b		[unknown]
CDS:CBG09043a	CBG09043a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054947
• Remark: CBG09043, ACTCATGCCGTTTGTGTCAAATCGAGTTTGGCGATAAAGCGAGTGCTCCAGCGAAGAAAT, WBGene00030710
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term