1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00004323 | rde-1 | K08H10.7 | Caenorhabditis elegans |
| WormBase ID | WBStrain00050716 | CGC Received | 2020-10-20 |
| Genotype | frSi21 II; frIs7 IV; rde-1(ne300) V. | Laboratory | CGC |
| Made By | WBPerson499 | Mutagen | CRISPR_Cas9 |
| Name | IG1846 | Outcrossed | x0 |
| Remark | frSi21 [col-62p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi21 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in adult epidermal tissues, making animals RNAi-deficient except for hypodermal (skin) tissues from the young adult stage. The frSi21 insertion can be detected using a primer within the inserted vector but outside the genomic rde-1 sequence included in the transgene (jep3108: ATcttgtgaccgaactgtcc) in combination with downstream primer (jep2445: caaaaaggcgggatgagcag), producing a 965 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc. Reference: https: | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00004323 | rde-1 | K08H10.7 | Caenorhabditis elegans |
