WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00050763 CGC Received  2020-10-21
Genotype  tbx-11(luc144) III. Laboratory  CGC
Name  MLC1946 Outcrossed  x0
Remark  Wild-type morphology. CRISPR/Cas9 engineered 1.3 kb deletion of the tbx-11 locus. Flanking sequence: aaaaataacaaaataacaaggaatgagaagggaaaacaggaaaaatacac / ttgccacgtgttgggcgggaaaacgcgtagtcatccggcaggtgtaacct Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421 Species  Caenorhabditis elegans
Paste the following link
Lists
This Strain isn't in any lists. Upload a list.

0 Alleles

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00006547 tbx-11 F40H6.4 Caenorhabditis elegans