WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00050914 CGC Received  2021-02-18
Genotype  nlp-79(sy1268) IV. Laboratory  CGC
Mutagen  CRISPR_Cas9 Name  PS8313
Outcrossed  xNo Remark  Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-79; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: aaattaaattcaacttttcaggtaaaATGTCCACTRight flanking sequence: CGGTGGTTTGTGTTCGTCGCCCTGATGGCTCTCGinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CAGGTAAAATGTCCACTCGGMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
Species  Caenorhabditis elegans

1 Alleles

Public Name
sy1268

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00008626 nlp-79 F09E8.8 Caenorhabditis elegans