1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00000708 | col-135 | M199.5 | Caenorhabditis elegans |
| WormBase ID | WBStrain00050932 | CGC Received | 2020-10-19 |
| Genotype | col-135(sy1435) IV. | Laboratory | CGC |
| Mutagen | CRISPR_Cas9 | Name | PS8634 |
| Outcrossed | xNo | Remark | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-135. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: CCAGCGCTCGGGTATAATATTCGATATCCCTCCTright flanking sequence: ATGAACCAAATCGACAATATGGCCCATATTCGAATGinserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGTCGATTTGGTTCATAGGMethod Reference: G3 (Bethesda). |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00000708 | col-135 | M199.5 | Caenorhabditis elegans |
