1 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00016428 | dmsr-7 | C35A11.1 | Caenorhabditis elegans |
WormBase ID | WBStrain00050976 | CGC Received | 2021-02-18 |
Genotype | dmsr-7(sy1539) V. | Laboratory | CGC |
Mutagen | CRISPR_Cas9 | Name | PS8854 |
Outcrossed | xNo | Remark | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-7; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: GATGCTCAGTTGTTTGATCCGAACAGTAACAGTARight flanking sequence: CGCAGGCATTTCTTCGGAAACTTGCACATTTTCAAAGinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCCGAACAGTAACAGTACGCMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
Species | Caenorhabditis elegans |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00016428 | dmsr-7 | C35A11.1 | Caenorhabditis elegans |