WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00136915 Gene Name  CJA17711
Sequence Name  ? CJA17711 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Family of unknown function (DUF5386) and Protein of unknown function DUF5386. Is an ortholog of C. elegans ZK512.8. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA17711.1 CJA17711.1   [unknown]
Transcript:CJA17711.2 CJA17711.2   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA17711 CJA17711   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA02784, CAATACAGCACGAATCAGCTTCAGGACGTGAAAAAGTTGGAGAAGCTGTCATCCACCCTG, WBGene00121988   Expr1077290 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA17711, GGATGAGAAAGTGGTGACCATTTACCAGCAAAGTGACGGGCAAACTTGTCTGTTCACATT, WBGene00136915   Expr1076381 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term