WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00050970 CGC Received  2020-10-19
Genotype  col-129(sy1528) IV. Laboratory  CGC
Mutagen  CRISPR_Cas9 Name  PS8821
Outcrossed  xNo Remark  Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-129. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: ccgtctggcaccaaatgATGACTGTTGTCCCACAright flanking sequence: AGGAGGCAAGCAACGTCAAGTCTACGAGTCCCTGTTCinserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATGACTGTTGTCCCACAAGGMethod Reference: G3 (Bethesda).
Species  Caenorhabditis elegans

1 Alleles

Public Name
sy1528

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00000703 col-129 M18.1 Caenorhabditis elegans