1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00018478 | otpl-5 | F45F2.5 | Caenorhabditis elegans |
| WormBase ID | WBStrain00050996 | CGC Received | 2021-02-18 |
| Genotype | otpl-5(sy1586) V. | Laboratory | CGC |
| Mutagen | CRISPR_Cas9 | Name | PS8943 |
| Outcrossed | xNo | Remark | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-5; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: GGAGAGCACAAGCACATCGGTAGCAATGTCCACATRight flanking sequence: CAGACGGGTTCAGTAGCCATGACGATATTTCACAATGinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTACTGAACCCGTCTGATG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00018478 | otpl-5 | F45F2.5 | Caenorhabditis elegans |
