WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00136340 Gene Name  CJA17137
Sequence Name  ? CJA17137 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: ACP-like superfamily; Phosphopantetheine attachment site; and Phosphopantetheine binding ACP domain. Is an ortholog of C. elegans F37C12.3. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA17137.1 CJA17137.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA17137 CJA17137   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA17137, GATAAGGAATCGCTTCTGAAACTTGACGCCGATTTTTCGAAAGATTTTGGTTTCGATTCT, WBGene00136340   Expr1076622 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term