WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00136139 Gene Name  Cjp-xrn-2
Sequence Name  ? CJA16935 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Xrn1, helical domain; Xrn1 helical domain; and 5'-3' exoribonuclease. Is an ortholog of C. elegans xrn-2. In C. elegans, xrn-2 is involved in several processes, including miRNA catabolic process; negative regulation of miRNA-mediated gene silencing; and regulation of vulval development. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA16935.1 CJA16935.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA16935 CJA16935   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA27808, TTTCGAAACTGTCGGAGAGTTCGTTCCGGATTTCTCGAGAAAAACAAAACCGTTCAATCC, WBGene00183381   Expr1080237 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA16935, ATGACGGATATCAACAGGATTATCAGCAACGAAGAGATGGCTATCAGGGTGGACATTCAC, WBGene00136139   Expr1080204 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term