WormMine: Gene WBGene00136817

• WormBase Gene ID: WBGene00136817
• Gene Name: Cjp-aco-1
• Sequence Name: CJA17615
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Aconitase C-terminal domain; Aconitase A/isopropylmalate dehydratase small subunit, swivel domain; Aconitase family (aconitate hydratase); Aconitase/Iron-responsive element-binding protein 2; Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 1/3; Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha domain; Aconitase/3-isopropylmalate dehydratase, swivel; and Aconitase, iron-sulfur domain. Is an ortholog of C. elegans aco-1. In C. elegans, aco-1 is involved in tricarboxylic acid metabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA17615.1	CJA17615.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA17615	CJA17615		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1089736
• Remark: Cjp-aco-1, GGTCATTTGCAGATTTGATACGGAAGTAGAGCTCACTTATTACCGTAATGGAGGAATTCT, WBGene00136817
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term