1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00013407 | fld-1 | Y63D3A.8 | Caenorhabditis elegans |
| WormBase ID | WBStrain00051872 | CGC Received | 2021-09-16 |
| Genotype | fld-1(et46) I. | Laboratory | CGC |
| Made By | WBPerson11984 | Mutagen | EMS |
| Name | QC153 | Outcrossed | x10 |
| Remark | The fld-1(et46) loss-of-function mutation has no obvious phenotype on its own but can act as a paqr-2 suppressor. fld-1(et46) carries a mutation in the splice acceptor site of intron 4, i.e. G>A. It can be detected using PCR with annealing at 65C and using the following primers: et46_WT: atcccccaaaaaacccaatttttttgtag; et46_mut:atcccccaaaaaacccaatttttttgtaa; et46_rev: CCGGAATTGAGACCACctggaac. Expected product size: 389. Reference: Ruiz M, et al. eLife 7:e40686. PMID: 30509349 | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00013407 | fld-1 | Y63D3A.8 | Caenorhabditis elegans |
