| WormBase ID | WBStrain00051615 | CGC Received | 2020-08-08 |
| Genotype | let-7(umn45[let-7p::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR])/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X. | Laboratory | CGC |
| Mutagen | CRISPR_Cas9 | Name | CGC135 |
| Remark | tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous let-7 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type GFP+ mScarlet+ and segregate wild-type GFP+ mScarlet+ heterozygotes, mScarlet+ non-GFP dead larvae (umn45 homozygotes) and Mec(Unc) non-mScarlet GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+ mScarlet+. Left Flanking: GCAAGCAGGCGATTGGTGGACGGTC, Right Flanking: AGCTGCGTCGTCTTGCTCTCACAAc. sgRNA: AAAATTGCATAGTTCACCGG. | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001182 | egl-13 | T22B7.1 | Caenorhabditis elegans |
| WBGene00002285 | let-7 | C05G5.6 | Caenorhabditis elegans |
| WBGene00002957 | let-858 | F33A8.1 | Caenorhabditis elegans |
| WBGene00006749 | unc-9 | R12H7.1 | Caenorhabditis elegans |
