WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00051773 CGC Received  2021-06-09
Genotype  dct-1(luc194) X. Laboratory  CGC
Mutagen  CRISPR_Cas9 Name  MLC2543
Outcrossed  x0 Remark  CRISPR/Cas9-engineered deletion removes the entire dct-t coding sequence. Homozygote mutant animals are viable and have normal morphology. Outer left sequence: gtttcagagacgggtctttcctaaca Outer right sequence: ttccaaacaaaaattttaacgttcgactta sgRNA1: ACAGCAGACGGAGCAGTCAT sgRNA2: GTACAGTGAAATGAGGTAAG Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
Species  Caenorhabditis elegans

0 Alleles

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00015776 dct-1 C14F5.1 Caenorhabditis elegans