1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00006803 | unc-70 | K11C4.3 | Caenorhabditis elegans |
| WormBase ID | WBStrain00051796 | CGC Received | 2021-11-30 |
| Genotype | unc-70(mir6[loxP] mir16[loxP]) V. | Laboratory | CGC |
| Name | MSB115 | Outcrossed | x1 |
| Remark | Superficially wild-type. LoxP sites were inserted into near the 5' and 3' ends of the endogenous unc-70 locus to facilitate conditional or cell-specific knockout of the gene. The 5' loxP site can be detected by PCR using the primers 5' tttattaatctatgatttttcagcaaaa 3' and 5' tgacgataatctcttaaaattttgc 3'. The 3' loxP site can be detected by PCR using the primers 5' acgtactgtcgctgaggttacc 3' and 5' gacgtcgatacaaataattcgtccca 3'. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987 | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00006803 | unc-70 | K11C4.3 | Caenorhabditis elegans |
