3 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001072 | dpy-10 | T14B4.7 | Caenorhabditis elegans |
| WBGene00002957 | let-858 | F33A8.1 | Caenorhabditis elegans |
| WBGene00002993 | lin-4 | F59G1.6 | Caenorhabditis elegans |
| WormBase ID | WBStrain00051632 | CGC Received | 2022-02-14 |
| Genotype | lin-4(umn84[lin-4p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722])/mIn1[dpy-10(e128) umnIs33] II. | Laboratory | CGC |
| Made By | WBPerson4823 | Mutagen | CRISPR_Cas9 |
| Name | CGC177 | Outcrossed | x0 |
| Remark | umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Nuclear mScarlet-I was inserted in place of the endogenous lin-4 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type mScarlet+ GFP+, and segregate wild-type mScarlet+ GFP+, Lin-4 mScarlet+ non-GFP (umn84 homozygotes), and Dpy non-mScarlet GFP+ (mIn1 homozygotes). Maintain by picking wild-type mScarlet+ GFP+. Left Flanking: AGAGTTTTGGTTGGTTTATGAGTTT, Right Flanking: CCAGGACGGTTTGAGCAGATCtttt. sgRNA: TGAGGTCTCAGGGAACAGGC. | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001072 | dpy-10 | T14B4.7 | Caenorhabditis elegans |
| WBGene00002957 | let-858 | F33A8.1 | Caenorhabditis elegans |
| WBGene00002993 | lin-4 | F59G1.6 | Caenorhabditis elegans |
