2 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00002957 | let-858 | F33A8.1 | Caenorhabditis elegans |
WBGene00003310 | mir-82 | T07D1.7 | Caenorhabditis elegans |
WormBase ID | WBStrain00051634 | CGC Received | 2022-02-23 |
Genotype | mir-82(umn87[mir-82p+SL1::EGL13NLS::lox2272mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. | Laboratory | CGC |
Mutagen | CRISPR_Cas9 | Name | CGC180 |
Outcrossed | x0 | Remark | Nuclear mScarlet-I was inserted in place of the endogenous mir-82 pre-miRNA via CRISPR/CAS9. Left Flanking: TATCATTCTCTCTACTACTAGTGAACTCAT, Right Flanking: TTATCAAGAAAATTCAAGAAAATTCAAAAG. sgRNA: CTGTAGATCACAGAGAAAAC. |
Species | Caenorhabditis elegans |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00002957 | let-858 | F33A8.1 | Caenorhabditis elegans |
WBGene00003310 | mir-82 | T07D1.7 | Caenorhabditis elegans |