2 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00002957 | let-858 | F33A8.1 | Caenorhabditis elegans |
| WBGene00003039 | mir-48 | F56A12.3 | Caenorhabditis elegans |
| WormBase ID | WBStrain00051625 | CGC Received | 2021-09-15 |
| Genotype | mir-48(umn59[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR]) V. | Laboratory | CGC |
| Mutagen | CRISPR_Cas9 | Name | CGC152 |
| Outcrossed | x0 | Remark | Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9. Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG. |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00002957 | let-858 | F33A8.1 | Caenorhabditis elegans |
| WBGene00003039 | mir-48 | F56A12.3 | Caenorhabditis elegans |
