1 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00000216 | asp-3 | H22K11.1 | Caenorhabditis elegans |
WormBase ID | WBStrain00051696 | CGC Received | 2022-04-27 |
Genotype | asp-3(utx47[mNG::3xFlag::asp-3]) X. | Laboratory | CGC |
Mutagen | CRISPR_Cas9 | Name | GLW57 |
Outcrossed | x0 | Remark | N-terminal tag of ASP-3 via CRISPR/Cas9 knock-in of mNeonGreen at asp-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcgctgcttctcaattagtgataacgcacc 3'; Right flank: 5' ATGTCGGGCCGCGTTTTCCTTCTTCTGGCT 3'; sgRNA: tagtgataacgcaccATGT (19 bp); Cas9/sgRNA plasmid: pGLOW74; mNG^SEC^3xFlag plasmid: pGLOW96; SEC insertion allele strain: GLW58. |
Species | Caenorhabditis elegans |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00000216 | asp-3 | H22K11.1 | Caenorhabditis elegans |