2 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001170 | egl-1 | F23B12.9 | Caenorhabditis elegans |
| WBGene00006843 | unc-119 | M142.1 | Caenorhabditis elegans |
| WormBase ID | WBStrain00051687 | CGC Received | 2021-12-21 |
| Genotype | muIs252 II; unc-119(ed3) III; egl-1(utx23[egl-1::wrmScarlet11::3xMyc]) V. | Laboratory | CGC |
| Mutagen | CRISPR_Cas9 | Name | GLW29 |
| Outcrossed | x0 | Remark | muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of EGL-1 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous egl-1 locus. Genetic background: strain CF4582. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' CAGAAGTCTCTTCCATCGTCTTCTGGACTTTTTCGCTTTT 3' (one silent mutation); Right flank: 5' TAAgtgatcaaaatctccaacttttctcca 3'; sgRNA: AGTCCAGAAGACGATGGAAG; Cas9/sgRNA plasmid: pGLOW65; wrmScarlet11^SEC^3xMyc plasmid: pGLOW66; SEC insertion allele strain: GLW28. |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001170 | egl-1 | F23B12.9 | Caenorhabditis elegans |
| WBGene00006843 | unc-119 | M142.1 | Caenorhabditis elegans |
