WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00051685 CGC Received  2021-11-22
Genotype  daf-18(utx19[mNG::3xFlag::daf-18]) IV. Laboratory  CGC
Mutagen  CRISPR_Cas9 Name  GLW25
Outcrossed  x0 Remark  Superficially wild type. N-terminal tag of DAF-18 via CRISPR/Cas9 knock-in of mNeonGreen at daf-18 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcagtttccaggtacatctactaaccccca 3'; Right flank: 5' ATGGTTACTCCTCCTCCAGATGTGCCAAGC 3'; sgRNA: GGAGGAGGAGTAACCATtgg; Cas9/sgRNA plasmid: pGLOW27; mNG^SEC^3xFlag plasmid: pGLOW53; SEC insertion allele strain: GLW24. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
Species  Caenorhabditis elegans

0 Alleles

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00000913 daf-18 T07A9.6 Caenorhabditis elegans