WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00071498 Gene Name  Cre-math-33.1
Sequence Name  ? CRE04345 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Ubiquitin-specific protease C-terminal; ICP0-binding domain of Ubiquitin-specific protease 7; Ubiquitin carboxyl-terminal hydrolase, C-terminal; Ubiquitin carboxyl-terminal hydrolase 7, ICP0-binding domain; and Papain-like cysteine peptidase superfamily. Is an ortholog of C. elegans math-33. In C. elegans, math-33 is involved in several processes, including anterior/posterior axis specification, embryo; hemidesmosome assembly; and maintenance of centrosome location. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE04345.1 CRE04345.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE04345 CRE04345   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE04345, GCTTTTCGGTGTCTCATTTGTCATCAAGATCCGTAACGGAGAGCTGATGACTGAAGTCAG, WBGene00071498   Expr1099273 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cre-math-33, GGAAGCATATGATGACTGCTGAACTCTATCTTTTCGTGAATGATAAGCTGTTCCAGAAGA, WBGene00066184   Expr1117671 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term