1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00012665 | pph-5 | Y39B6A.2 | Caenorhabditis elegans |
| WormBase ID | WBStrain00052057 | CGC Received | 2022-03-30 |
| Genotype | pph-5(udn91) V. | Laboratory | CGC |
| Mutagen | CRISPR_Cas9 | Name | UDN100161 |
| Outcrossed | x2 | Remark | pph-5 [A48T] #2 variant edit from Fielder, et al. (2022). Includes addition of silent AvaII restriction site and silent PAM ablation. Homozygous viable and superficially wild-type. Genotype using primers Forward: accggaaattgtcccaaaat, Reverse: tttccgactttctggaggtg. Digest with AvaII restriction enzyme for resulting sizes of 401bp +403bp. Wild-type product will not be digested. |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00012665 | pph-5 | Y39B6A.2 | Caenorhabditis elegans |
