WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00033342 Gene Name  Cbr-fog-3
Sequence Name  ? CBG12385 Organism  Caenorhabditis briggsae
Automated Description  Expressed in male. Is an ortholog of C. elegans fog-3. In C. elegans, fog-3 is involved in cell fate specification; developmental process involved in reproduction; and positive regulation of oocyte development. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG12385.1 CBG12385.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG12385 CBG12385   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr11505 The expression of C. briggsae fog-3 was highest during the L4 larval stage, when the animals produce sperm, but that expression was low during adulthood, when the animals make only oocytes.  
Cbr-fog-3, GTGCTACCGAGAATGGAGTCGATGTTCCAATCTGGAAAGGAGACGTGAATACTGATTCAC, WBGene00033342   Expr1051638 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term