WormMine: Gene WBGene00079017

• WormBase Gene ID: WBGene00079017
• Gene Name: CRE05809
• Sequence Name: CRE05809
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Protein of unknown function DUF713 and Protein of unknown function (DUF713). Is an ortholog of C. elegans B0507.6 and F53H2.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE05809.1	CRE05809.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE05809	CRE05809		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1114525
• Remark: CRE05809, ATGTGTGGCCGACGTAGCAAATAAGCTACTTGAAATTATCGAACTCCTTGTTCAGCAGGA, WBGene00079017
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term