WormMine: Gene WBGene00214402

• WormBase Gene ID: WBGene00214402
• Gene Name: CJA38555
• Sequence Name: CJA38555
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domain: Protein kinase-like domain superfamily. Is an ortholog of C. elegans C27D8.1; F53C3.1; and Y39G8C.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA38555.1	CJA38555.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA38555	CJA38555		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1089671
• Remark: CJA05735, GATGTGCTCGATTATATTGATTCGAGACAATATCAGGACCGCATGGACTATATTTACATT, WBGene00124939
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term